Journal: Journal of cancer therapy

Article Title: Saporin Conjugated Monoclonal Antibody to the Transcobalamin Receptor TCblR/ CD 320 Is Effective in Targeting and Destroying Cancer Cells

doi: 10.4236/jct.2013.46122

Figure Lengend Snippet: TCblR expression profile and concentration of mAb-Saporin required for inhibiting cell proliferation.

Article Snippet: SW48 [SW-48] , ATCC CCL-231 , colorectal adenocarcinoma, epithelial , 35 , 20 , 37 , 18 , 10 , 7 , <0.05 , 1.7 , <0.05.

Techniques: Expressing, Concentration Assay, Binding Assay

Journal: Oncotarget

Article Title: BRG1 targeting STAT3/VEGFC signaling regulates lymphangiogenesis in colorectal cancer

doi: 10.18632/oncotarget.9038

Figure Lengend Snippet: A. Expression of BRG1 protein and VEGFC mRNA in 8 cultured CRC cell lines (HT29, HCT116, LoVo, Caco-2, KM12, SW48, SW480 and SW620). B. (Left) Analyses showing the expression of BRG1 protein and VEGFC mRNA in 10 freshly human CRC tissues. (Right) BRG1 protein expression was negatively correlated with VEGFC mRNA expression in 10 freshly human CRC tissues. C. (Left) BRG1 levels were negatively correlated with VEGFC expression in primary human CRC specimens ( n =31). Micrographs of BRG1 and VEGFC expression level in human CRC tissues. Original magnification, ×100. (Right) Percentage of CRC specimens with low or high BRG1 expression relative to VEGFC expression. * p <0.05.

Article Snippet: All CRC cell lines (LoVo, SW480, HT29, HCT116, Caco-2, KM12, SW48 and SW620) and the HEK293T cell line were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Expressing, Cell Culture

Journal: Cell Communication and Signaling : CCS

Article Title: Herbal formula Huang Qin Ge Gen Tang enhances 5-fluorouracil antitumor activity through modulation of the E2F1/TS pathway

doi: 10.1186/s12964-018-0218-1

Figure Lengend Snippet: IC 50 values of HQGGT in human colon cancer cell lines

Article Snippet: Human colon cancer cells HT-29 (KRAS wt , BRAF V600E , TP53 R273H ), RKO (KRAS wt , BRAF V600E , TP53 wt ), and SW48 (KRAS wt , BRAF wt , TP53 wt ), and normal human colon epithelial CCD841 CoN cells were purchased from American Type Culture Collection (ATCC; Rockville, MD).

Techniques:

Journal: Molecular cell

Article Title: S1-END-seq reveals DNA secondary structures in human cells.

doi: 10.1016/j.molcel.2022.08.007

Figure Lengend Snippet: Figure 2. S1-END-seq reveals S1-sensitive homopurine/homopyrimidine (hPu/hPy) repeats genome wide (A) Number of S1-END-seq peaks at hPu/hPy repeats (red), (TA)n repeats (gray), and other peaks (black) in MSI (KM12, SW48, and RKO) and MSS (SW620 and SW837) colon cancer cell lines. (B) Quantification of S1-END-seq versus END-seq intensities (RPKM, reads per kilobase per million mapped reads) at hPu/Py repeat peaks in two independent experimental replicates in KM12 cells performed in parallel. The top, center mark, and bottom hinges of the box plots, respectively, indicate the 90th, median, and 10th percentile values. Statistical analysis: Wilcoxon rank sum test, **** p < 0,0001. (C) Genome browser screenshots as normalized read density (reads per million, RPM) for S1-END-seq and END-seq in KM12 cells. Plus- and minus-strand reads are displayed in black and gray, respectively.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanobind Big DNA CBB kit Circulomics Cat# NB-900-001-01 Deposited data Raw and analyzed data This paper GEO: GSE204808 Repli-seq HCT116 Du et al., 2021 GEO: GSE158008 Repli-seq HeLa UCSC Genome Browser wgEncodeUwRepliSeqHelas3 WaveSignalRep1 Somatic mutations in cancer The International Cancer Genome Consortium Data Portal https://dcc.icgc.org/releases/ release_28/ Experimental models: Cell lines Human: iPS cell Coriell WTC11 Human: KM12 (shWRN) Chan et al., 2019 N/A Human: SW837 CCLE Broad Institute N/A Human: SW48 CCLE Broad Institute N/A Human: SW620 ATCC CCL-227 Human: RKO ATCC CRL-2577 Human: RPE-hTERT TP53KO Gift from Dr. Daniel Durocher laboratory N/A Human: RPE-hTERT TP53KO MLH1KO This paper N/A Human: HEK293T ATCC CRL-3216 Human: HACAT Gift from Dr. Ramiro Iglesias- Bartolome laboratory N/A Human: HeLa ATCC CCL-2 Human: MCF10A ATCC CRL-10317 Human: Primary human skin fibroblasts Gift from Dr. Christopher Pearson laboratory 602-05 Human: Normal human epithelial keratynocytes (NHEK) Gift from Dr. Ramiro IglesiasBartolome laboratory N/A Human: Transformed B-Lymphocyte cell line derived from FRDA patient Gift from Dr. Karen Usdin laboratory GM15850 Human: Transformed B-Lymphocyte cell line derived from healthy sibling of FRDA patient Gift from Dr. Karen Usdin laboratory GM15851 Oligonucleotides MLH1 sgRNA target sequence 5’-GATGGTTCG TACAGATTCCC-3’ https://portals.broadinstitute.org/ gppx/crispick/public This paper END-seq adaptor 1, 50-phosphate -GATCGGA AGAGCGTCG TGTAGGGAAAGAGTGUU[Biotin-dT]U[BiotindT]UUACACTC TTTCCCTACACGACGCTCTTCCGATC*T-30 Canela et al., 2016 N/A END-seq adaptor 2, 50-phosphate -GATCGGA AGAGCACAC GTCUUUUUUUUAGACGTGTGCTCTTCCGA TC*T-30 Canela et al., 2016 N/A Software and algorithms DeepVariant (v1.1.0) N/A https://github.com/google/deepvariant Pbsv N/A https://github.com/PacificBiosciences/ pbsv deepTools suite Ramı́rez et al., 2016 https://deeptools.readthedocs.io/en/ develop/ GraphPad prim v8 GraphPad https://www.graphpad.com (Continued on next page) e2 Molecular Cell 82, 3538–3552.e1–e5, October 6, 2022

Techniques: Genome Wide

Journal: Molecular cell

Article Title: S1-END-seq reveals DNA secondary structures in human cells.

doi: 10.1016/j.molcel.2022.08.007

Figure Lengend Snippet: Figure 3. S1-END-seq peaks in hPu/hPy mirror repeats display asymmetric strand polarity (A) Representative genome browser screenshots as normalized read density (reads per million, RPM) for S1-END-seq peaks at hPu/hPy repeats (GAAA and TTTC) in five different colon cancer cell lines KM12, SW48, RKO, SW620, and SW837. Black triangles represent the plus strand repeat annotation. Plus- and minus-strand reads are displayed in black and gray, respectively. (B) Aggregate plots (top) and heatmaps (bottom) of S1-END-seq intensity flanking 500 bp at the center of S1 sensitive hPu/hPy mirror repeats in KM12. The data displays S1-END-seq intensity using full read length (left) or using the first (50) nucleotide sequenced (right). (C) Schematic representation of potential H-DNA structures (H-r5 and H-y3) that are consistent with the strand bias observed in S1-END-seq peaks. Ho- mopurine (hPu) mirror repeats are represented in red, and homopyrimidine (hPy) mirror repeats are rep- resented in blue.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanobind Big DNA CBB kit Circulomics Cat# NB-900-001-01 Deposited data Raw and analyzed data This paper GEO: GSE204808 Repli-seq HCT116 Du et al., 2021 GEO: GSE158008 Repli-seq HeLa UCSC Genome Browser wgEncodeUwRepliSeqHelas3 WaveSignalRep1 Somatic mutations in cancer The International Cancer Genome Consortium Data Portal https://dcc.icgc.org/releases/ release_28/ Experimental models: Cell lines Human: iPS cell Coriell WTC11 Human: KM12 (shWRN) Chan et al., 2019 N/A Human: SW837 CCLE Broad Institute N/A Human: SW48 CCLE Broad Institute N/A Human: SW620 ATCC CCL-227 Human: RKO ATCC CRL-2577 Human: RPE-hTERT TP53KO Gift from Dr. Daniel Durocher laboratory N/A Human: RPE-hTERT TP53KO MLH1KO This paper N/A Human: HEK293T ATCC CRL-3216 Human: HACAT Gift from Dr. Ramiro Iglesias- Bartolome laboratory N/A Human: HeLa ATCC CCL-2 Human: MCF10A ATCC CRL-10317 Human: Primary human skin fibroblasts Gift from Dr. Christopher Pearson laboratory 602-05 Human: Normal human epithelial keratynocytes (NHEK) Gift from Dr. Ramiro IglesiasBartolome laboratory N/A Human: Transformed B-Lymphocyte cell line derived from FRDA patient Gift from Dr. Karen Usdin laboratory GM15850 Human: Transformed B-Lymphocyte cell line derived from healthy sibling of FRDA patient Gift from Dr. Karen Usdin laboratory GM15851 Oligonucleotides MLH1 sgRNA target sequence 5’-GATGGTTCG TACAGATTCCC-3’ https://portals.broadinstitute.org/ gppx/crispick/public This paper END-seq adaptor 1, 50-phosphate -GATCGGA AGAGCGTCG TGTAGGGAAAGAGTGUU[Biotin-dT]U[BiotindT]UUACACTC TTTCCCTACACGACGCTCTTCCGATC*T-30 Canela et al., 2016 N/A END-seq adaptor 2, 50-phosphate -GATCGGA AGAGCACAC GTCUUUUUUUUAGACGTGTGCTCTTCCGA TC*T-30 Canela et al., 2016 N/A Software and algorithms DeepVariant (v1.1.0) N/A https://github.com/google/deepvariant Pbsv N/A https://github.com/PacificBiosciences/ pbsv deepTools suite Ramı́rez et al., 2016 https://deeptools.readthedocs.io/en/ develop/ GraphPad prim v8 GraphPad https://www.graphpad.com (Continued on next page) e2 Molecular Cell 82, 3538–3552.e1–e5, October 6, 2022

Techniques:

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Effect of ATRi on radiosensitivity. (A) ARID1A expression in colon cancer lines; (B) Effect of ATRi (VE822) on radiosensitivity. ARID1A+ and ARID1A- cell lines were pre-treated for 1 h with 20 nM VE822 and irradiated with 0 Gy, 2 Gy, 4 Gy and 6 Gy. Plating efficiency of sham treated (untr) and VE822 treated (ATRi) cells were plotted as log10 for ARID1A + and ARID1A - cell lines. Results of 3 independent experiments are shown for CRC cell lines.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques: Expressing, Irradiation

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Cell cycle effect of ATRi/ARID1A. (A) Synchronized cells in early S phase and mid S phase were pre-treated for 1 h with VE822 and irradiated thereafter with 0 Gy, 2 Gy and 4 Gy. Plating efficiency of sham treated (untr) and VE822 treated (ATRi) cells were plotted as log10 for ARID1A + and ARID1A - cell lines. (B) Exit from G2 phase into the M phase was measured after treatment with VE822 and irradiation in ARID1A - SW48 and ARID1A + HCT116 cell lines. Fraction of phospho-histone H3 positive cells were plotted against time after irradiation. MI = phospho-histone H3 in radiation/phospho-histone H3 in no-radiation × 100%. Results of 3 independent experiments are shown for CRC cell lines.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques: Irradiation

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Effect of ATRi on ɣH2AX foci formation in G2-phase CRC cell lines.Maximum intensity projection (MIP) images of γH2AX foci (red) at tmax (1h) in G2-phase ARID1A + (A, B) and ARID1A - (C, D) cells without (untr) and with 20 nM VE822 (ATRi) in EdU - (green) cells after exposure to the indicated IR doses. Cells were counterstained with DAPI (blue). The respective numbers of γH2AX foci at tmax as a function of IR dose are shown in (B) (ARID1A + cells) and (D) (ARID1A - cells). Results of 3 independent experiments are shown for CRC cell lines.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques:

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Effect of ATRi on RAD51 foci formation in G2-phase CRC cells. Maximum intensity projection (MIP) images of RAD51 foci (red) at tmax (6h) in G2-phase ARID1A+ (A, B) and ARID1A- (C, D) cells without (untr) and with 20 nM VE822 (ATRi) in EdU- (green) cells after exposure to the indicated IR doses. Cells were counterstained with DAPI (blue). The respective numbers of Rad51 foci at tmax as a function of IR dose are shown in (B) (ARID1A+ cells) and (D) (ARID1A- cells). Results of 3 independent experiments are shown for CRC cell lines.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques:

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Effect of ATRi on HR repair in reporter cell lines. (A) Western blot results of ARID1A knock-down in DR-GFP-U2OS and DR-GFP-A549 reporter cells; GAPDH was used as an internal control. (B) Normalized GFP expression in DR-GFP- U2OS and DR-GFP-A549 reporter cells after treatment with control siRNA (mock), 20 nM VE822 (ATRi), ARID1A specific siRNA (siARID1A) and ATRi after knock-down of ARID1A (siARID1A, ATRi). (C) Normalized GFP expression in SA-GFP- U2OS reporter cells after treatment with control siRNA (mock), 20 nM VE822 (ATRi), ARID1A specific siRNA (siARID1A) and ATRi after knock-down of ARID1A (siARID1A, ATRi). (D) Normalized GFP expression in EJ2-GFP- U2OS reporter cells after treatment with control siRNA (mock), 20 nM VE822 (ATRi), ARID1A specific siRNA (siARID1A) and ATRi after knock-down of ARID1A (siARID1A, ATRi).Results of 3 independent experiments are shown for CRC cell lines.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques: Western Blot, Knockdown, Control, Expressing

Journal: Frontiers in Oncology

Article Title: Selective vulnerability of ARID1A deficient colon cancer cells to combined radiation and ATR-inhibitor therapy

doi: 10.3389/fonc.2022.999626

Figure Lengend Snippet: Effect of ATRi on ex vivo explants from CRC patients. (A) Example of IHC staining of ARID1A expression from clinical CRC tumor cells with and without ARID1A expression. (B) Western blot of CK20 expression from primary CRC cells; GAPDH was used as an internal control. (C) ATP-Tumor Chemosensitivity Assay for the effect of the ATR inhibitor VE822 on ex-vivo cells from CRC patients. ATP activity was measured after treatment of ex-vivo cells with concentration ranged from 0, 2.5 up to 100 nM in cells from CRC patients with (+) and without (-) ARID1A expression.

Article Snippet: The human CRC cell lines with mutant (LS180, RKO, SW48) and wild-type (HCT15, HCT116 and Colo320DM) ARID1A were obtained from ATCC (LGC Standards, Wesel, Germany) and were designated as ARID1A - and ARID1A + cells, respectively.

Techniques: Ex Vivo, Immunohistochemistry, Expressing, Western Blot, Control, Activity Assay, Concentration Assay

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: CircRNA_0000392 promotes colorectal cancer progression through the miR-193a-5p/PIK3R3/AKT axis

doi: 10.1186/s13046-020-01799-1

Figure Lengend Snippet: Identification of circular RNAs by RNA-seq analyses in human CRC samples. a The scatter plot shows the changes in circRNA expression in six paired CRC and adjacent normal tissues (ANT). CircRNAs above the top green line and below the bottom green line demonstrated a greater than 1.5-fold change between the two compared groups. b The volcano plot shows the expression profiling of circRNA between CRC and ANT. The vertical green lines refer to a 2.0-fold (log2 scaled) upregulation and downregulation, respectively. The horizontal green line corresponds to a P -value of 0.05 (−log10 scaled). The red points in the plot represent differentially expressed circRNAs with statistical significance. c Clustered heat map indicating differences in circRNA expression profiling between CRC and ANT tissues. d The number of total circRNAs identified by RNA-seq and the number of differentially expressed circRNAs. e CircRNAs were classified by categories. f Validation of the top 4 differentially expressed circRNAs in 16 paired CRC and ANT tissues by RT-qPCR. CRC, colorectal cancer; ANT, adjacent normal tissue. Data represent the mean ± SD. * P < 0.05, ** P < 0.01

Article Snippet: Human CRC cell lines (HT29, HCT116, SW480, SW837, SW48, SW620 and RKO) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA).

Techniques: RNA Sequencing, Expressing, Biomarker Discovery, Quantitative RT-PCR

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: CircRNA_0000392 promotes colorectal cancer progression through the miR-193a-5p/PIK3R3/AKT axis

doi: 10.1186/s13046-020-01799-1

Figure Lengend Snippet: Knockdown of circRNA_0000392 inhibits CRC cell proliferation and invasion. a qRT-PCR analysis of circRNA_0000392 in SW620 and RKO cells after transfection with siRNA for 48 h. b - c SW620 and RKO cell proliferation after circRNA_0000392 knockdown by siRNA was detected by WST-1 assay. d The apoptosis rate was analyzed by flow cytometry after downregulation of circRNA_0000392 in SW620 and RKO cells. (E - F) Cell migration ( e ) and invasion ( f ) were assessed by transwell assay with or without Matrigel after circRNA_0000392 knockdown in SW620 and RKO cells. Data represent the mean ± SD. * P < 0.05, ** P < 0.01

Article Snippet: Human CRC cell lines (HT29, HCT116, SW480, SW837, SW48, SW620 and RKO) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA).

Techniques: Knockdown, Quantitative RT-PCR, Transfection, WST-1 Assay, Flow Cytometry, Migration, Transwell Assay

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: CircRNA_0000392 promotes colorectal cancer progression through the miR-193a-5p/PIK3R3/AKT axis

doi: 10.1186/s13046-020-01799-1

Figure Lengend Snippet: CircRNA_0000392 functions as a sponge for miR-193a-5p. a RIP analysis of circRNA_0000392 using anti-AGO2 antibody in SW620 and RKO cells. b The circRNA-miRNA-mRNA interaction based on circRNA_0000392 was demonstrated by prediction and bioinformatics analysis using Cytoscape software. c The top five miRNAs that may be regulated by circRNA_0000392 based on the miRNA prediction and bioinformatics analyses are shown and measured by qRT-PCR after the pull-down assay in RKO cells. d Schematic illustration demonstrating the luciferase reporter vectors containing wild-type (WT) or mutant (MUT) predicted miR-193a-5p binding sites of circRNA_0000392. e The luciferase assay was performed in 293 T cells after cotransfection with miR-193a-5p mimic and the luciferase vector containing wild-type (WT) or mutant (MUT) circRNA_0000392. f Relative expression of miR-193a-5p in 40 pairs of CRC and ANT tissues measured by qRT-PCR. g The correlation between circRNA_0000392 and miR-193a-5p in CRC tissues was analyzed by Spearman correlation coefficients. Data represent the mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001

Article Snippet: Human CRC cell lines (HT29, HCT116, SW480, SW837, SW48, SW620 and RKO) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA).

Techniques: Software, Quantitative RT-PCR, Pull Down Assay, Luciferase, Mutagenesis, Binding Assay, Cotransfection, Plasmid Preparation, Expressing

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: CircRNA_0000392 promotes colorectal cancer progression through the miR-193a-5p/PIK3R3/AKT axis

doi: 10.1186/s13046-020-01799-1

Figure Lengend Snippet: PIK3R3 is directly targeted by miR-193a-5p and indirectly regulated by circRNA_0000392. a The relative mRNA expression of EPHA2, PIK3R3, EGFR, USP22 and DDX58 after transfection with the miR-193a-5p inhibitor was detected in SW620 cells by qRT-PCR. b Schematic illustration of PIK3R3 3’UTR wild-type (WT) or 3’UTR mutant (MUT) luciferase reporter vectors and the predicted binding sites to miR-193a-5p. c The relative luciferase activities were detected in 293 T cells after cotransfection with the PIK3R3 3’UTR wild-type (WT) or 3’UTR mutant (MUT) luciferase reporter vectors with the miR-193a-5p mimics. d Relative PIK3R3 mRNA expression after transfection with the miR-193a-5p mimics or inhibitor was detected in cells by qRT-PCR. e The relative PIK3R3 protein level after transfection with the miR-193a-5p mimics was detected in cells by western blot. f Relative expression of PIK3R3 in 40 pairs of CRC and ANT tissues measured by qRT-PCR. g Relative PIK3R3 mRNA expression after transfection with circRNA_0000392 siRNA was detected by qRT-PCR. h Representative IHC staining images of low and high PIK3R3 expression in patient CRC tissue samples. Scale bar = 20 μm. i The correlation between circRNA_0000392 and PIK3R3 protein expression in CRC tissues was analyzed based on Spearman correlation coefficients. Data represent the mean ± SD. * P < 0.05, ** P < 0.01

Article Snippet: Human CRC cell lines (HT29, HCT116, SW480, SW837, SW48, SW620 and RKO) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA).

Techniques: Expressing, Transfection, Quantitative RT-PCR, Mutagenesis, Luciferase, Binding Assay, Cotransfection, Western Blot, Immunohistochemistry

Journal: Journal of Experimental & Clinical Cancer Research : CR

Article Title: CircRNA_0000392 promotes colorectal cancer progression through the miR-193a-5p/PIK3R3/AKT axis

doi: 10.1186/s13046-020-01799-1

Figure Lengend Snippet: Downregulation of circRNA_0000392 suppresses the growth of CRC cells in vivo. a Image of subcutaneous xenograft tumors. Nude mice were injected with 5 × 10 6 SW620 cells ( n = 5 for each group). Tumors were extracted after 30 days. b Analysis of tumor volume of mice measured every 3 days. c Tumor weight in each group at the end of the experiment. d Histological analysis of tumor tissues by hematoxylin and eosin staining. IHC of Ki-67 and PIK3R3 in subcutaneous tumors. Scale bar, 100 μm. e The graph shows the relative signal intensity scores of KI-67 and PIK3R3. f Schematic illustration of circRNA_0000392 regulating the miR-193a-5p/PIK3R3 axis in CRC. Data represent the mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001. Additional file

Article Snippet: Human CRC cell lines (HT29, HCT116, SW480, SW837, SW48, SW620 and RKO) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA).

Techniques: In Vivo, Injection, Staining

Journal: mBio

Article Title: The TLR3/IRF1/Type III IFN Axis Facilitates Antiviral Responses against Enterovirus Infections in the Intestine

doi: 10.1128/mBio.02540-20

Figure Lengend Snippet: EV71 infection mainly induces type III interferon in IECs. (A) The human normal (FHC and HCoEpiC) and cancerous (HT29, HCT116, DLD1, LoVo, and SW48) intestinal cell lines were treated with poly(I·C) at a dose of 3 μg/ml for 6 h or 12 h. Human IFN and ISG gene expression was detected by qPCR analysis. Data are shown as a fold change (log 10 ) relative to control (0-h group). (B) Seven human intestine cell lines were incubated with EV71 (MOI = 1) for 12 h or 24 h. The total mRNA of treated cells was extracted. Type I IFN ( IFN-α [specific for IFN-α1 and IFN-α13 ] and IFN-β ) and type III IFN ( IFN-λ1 and IFN-λ2/3 ) mRNA levels were assessed by qPCR and visualized in a heatmap of expression values (log 10 [fold change]). Data are representative of at least two independent experiments. (C and D) FHC cells were treated with EV71 at an MOI of 2 for 12 and 24 h (C) or at MOI of 2 and 5 for 12 h (D). HT29 cells were infected with EV71 at an MOI of 1 for 0, 8, 12, 24, and 36 h (C) or at MOI of 0, 0.5, 1, 2, 4, and 8 for 24 h (D). Type I IFN ( IFN-α and IFN-β ) and type III IFN ( IFN-λ1 and IFN-λ2/3 ) mRNA levels were detected by qPCR and normalized to the GAPDH mRNA level, and results are expressed as fold induction relative to control. * and # indicate the statistical significance for IFN-λ1 and IFN-λ2/3 mRNA levels relative to each control, respectively. (E) ELISA of IFN-β and IFN-λ1 production in the supernatant of FHC (MOI = 2) and HT29 (MOI = 1) cells treated with EV71 for the indicated time. Data are shown as mean ± SD and correspond to a representative experiment out of three performed. ns, nonsignificant; **, P < 0.01; ***, P < 0.001. ND, not detected. Statistical significance was determined by Student’s t test.

Article Snippet: Human intestinal cells (FHC, HCoEpiC, HT29, HCT116, DLD1, LoVo, and SW48), human rhabdomyosarcoma (RD) cells, and a human embryonic kidney cell line (HEK293T) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Infection, Gene Expression, Control, Incubation, Expressing, Enzyme-linked Immunosorbent Assay

Journal: mBio

Article Title: The TLR3/IRF1/Type III IFN Axis Facilitates Antiviral Responses against Enterovirus Infections in the Intestine

doi: 10.1128/mBio.02540-20

Figure Lengend Snippet: EV71 infection triggers the TLR3/IRF1/type III IFN signaling in human intestines. (A to E) Uninfected intestinal tissue samples ( n = 3) and EV71-infected intestinal tissue specimens ( n = 4) were collected from deceased human individuals. The small intestine tissue sections were analyzed by H&E staining (A) or immunohistochemistry using antibodies against dsRNA (B), IL-28+IL-29 proteins (C), TLR3 protein (D), and IRF1 protein (E). Positive staining is represented by brown coloration in these representative images. Light microscopy, bar = 100 μm. The relative levels of proteins were quantified with Image J software and are expressed as a positive score. Graphs show mean ± SEM. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Statistical significance was determined by Student’s t test. (F) Pearson’s correlation analyses of H&E scores, the viral dsRNA expression, IL-28+IL-29 production, TLR3 protein, and IRF1 protein in the 7 human intestine specimens. Statistical significance was determined by two-tailed t test.

Article Snippet: Human intestinal cells (FHC, HCoEpiC, HT29, HCT116, DLD1, LoVo, and SW48), human rhabdomyosarcoma (RD) cells, and a human embryonic kidney cell line (HEK293T) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Infection, Staining, Immunohistochemistry, Light Microscopy, Software, Expressing, Two Tailed Test

Journal: mBio

Article Title: The TLR3/IRF1/Type III IFN Axis Facilitates Antiviral Responses against Enterovirus Infections in the Intestine

doi: 10.1128/mBio.02540-20

Figure Lengend Snippet: A proposed model underlying the TLR3/IRF1 signaling pathway. TLR3/IRF1 signaling regulates type III interferon production and antiviral activity in intestinal epithelial cells upon enterovirus infection. Upon infection by enterovirus in human or murine intestine tissues, intestinal epithelial cells are the first line of defense against virus infection. Viral dsRNA is recognized by TLR3 to trigger signaling events, and then TLR3-IRF1 signaling is activated. The IRF1 is translocated into the nucleus to induce the differential accumulation of type III interferon production, resulting in the activation of the innate immune antiviral response in intestinal epithelial cells.

Article Snippet: Human intestinal cells (FHC, HCoEpiC, HT29, HCT116, DLD1, LoVo, and SW48), human rhabdomyosarcoma (RD) cells, and a human embryonic kidney cell line (HEK293T) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

Techniques: Activity Assay, Infection, Virus, Activation Assay